OBJECTIVE:Ministries

Turn to OBJECTIVE for an objective Christian perspective

Wacky Evolutionists

Article Index Creation Science News Dawkins Watch

Those Wacky Evolutionists!

Evolutionist Shenanigans & Assorted Darwinalia

With Commentary by Dr. Richard Paley

Evolutionists... You never know what wacky nonsense they'll spout next! On this page, I will collect and dissect the excesses of their unsupportable philosophy and various bits of amusing Darwinalia. While this could be viewed as a humorous, even cruel, endeavor, my intention is not to mock (although sometimes it is impossible not to, given the source material.) Instead, I hope to expose exactly what passes for Evolutionist thought and why it is so flawed, so that the Truth of Creation will stand out even more stark against the background of Evolutionism that our culture has been draped in.

For more objective news on Evolutionism see: Evolution News & Views from the unbiased Center for Science & Culture.

NOTE: Since militant Atheist Richard Dawkins has been monopolizing the "Wacky Evolutionist" title in most of these reports, I have moved all his articles to his own page: Dawkins Watch (please update your links.) Go there to learn more about this arch-Athevolutionist and his twisted worldview.

Articles On Evolutionism:

(These are also listed on my main page.)

Evolutionism Propaganda:
Examples of how Evolutionists spread their false doctrines using PBS, children's programming, and the Apple Macintosh.
"Aquatic Ape Theory":
Evolutionists sink to new lows, leagues under the sea.
The Eye:
Complicated and purposefully designed. Could random mutations really do that?

News:

Evolutionists Claim Nessie Is An Elephant
03/09/2006 Evolutionists -- desperate to deny the contemporary existence of animals that they claim went extinct "millions" of years ago -- have had to come of with some pretty bizarre hand-waving to explain away the evidences, but this one really takes the cake!

The animal whose existence they are denying this time is the Loch Ness Monster, better known as Nessie. Creation Science research has revealed that sightings of Nessie and Nessie-type animals are the result of extant Leviathan. Loch Ness sightings are of members of a plesiosaur family living in Scotland since they were deposited there over 4,000 years ago during the Great Flood.

But Neil Clark, curator of Evolutionism at the Hunterian Museum, is now claiming that Nessie is actually an elephant escaped from the circus. He thinks that sightings can be explained away as the unsubmerged trunk and head/back humps of an elephant out in Loch Ness enjoying a nice little swim while waiting for the clowns to finish their frolicking.

The idea that sightings of animals that Evolutionism says can't be alive today should be chalked up as merely elephants is preposterous. What's next? Are pterosaurs actually elephants with hang gliders?

Crazy Darwinist Paranoia
10/07/2005 In response to growing Darwinist ravings over a Darwinist urban legend popular among true-Darwinism-believers on the Darwinist fringe, Evolution News & Views offers some reasoned clarifications: How Darwinist Paranoia Fueled an Urban Legend.

It seems that Darwinists, unable to scientifically support their Darwinism in classrooms, are instead seeking to incite paranoia among credulous Darwinists. These fringe Darwinists, lead by Crazy Doc. Barb, are claiming that the "Wedge Document" -- in reality a modest Discovery Institute fundraising proposal -- is part of a vast anti-Darwinian conspiracy to suppress Darwinism and persecute Darwinists. These crazy Darwinists, driven loopy by their Darwinism, are so incapable of separating their Darwinian Materialism from real science -- such as practiced by Intelligent Design theoreticians and theobiologists -- that the reasonable goal of overthrowing materialism and its cultural legacies, errecting in their place a true science consonant with Christianity, becomes an attempt to impose a theocracy on Darwinists.

I guess Darwinists have to keep themselves busy waiting for cats to evolve into dogs. As Rob Crowther puts it in the article:

Don't Darwinists have better ways to spend their time than inventing absurd conspiracy theories about their opponents? The longer Darwinists persist in spinning such urban legends, the more likely it is that fair-minded people will begin to question whether Darwinists know what they are talking about.

Darwinists! Is there no wacky idea they won't buy into?

Crazy Doc. Barb Radio Interview
09/30/2005 "Dr" Barb Forrest -- a supposed "expert" witness for the Evolutionists in the Dover Trial whose only accomplishment is writing a crazy conspiracy theory book called Creationism's Trojan Horse, which the judge deemed inadmissible hearsay that reads like a magazine article -- was interviewed recently and manages to make herself seem even crazier than previously thought. I would almost think this was parody if the transcript wasn't on the Discovery Institute's news site. Read this crazy exchange between her (BF) and host Marvin Waldburger (MW):

BF: It's simple Marv. The people claiming that intelligent design is science aren't real scientists.

MW: I see, that's heavy. But look, some of these people have real degrees. I mean Mike Behe has a Ph.D. in biochemistry, right? And William Dembski has two degrees, one in mathematics and the other in philosophy. And also there is Jonathan Wells. I mean he has a degree in biology, too. What do you say to that?

BF: Those aren't real Ph.D.s Marv. They only look like real Ph.D's. One of the things we've learned from Darwin is that a lot of Ph.D's look real that aren't real at all.

MW: Amazing. Isn't that sort of like things in biology that look like they were designed but really aren't?

BF: Exactly.

She's just crazy! Next she'll be saying there's no such scientific field as theobiology!

Son of Piltdown Man: Evolutionism in Shambles
02/21/2005 It's happened again: Evolutionism has been shown to be a fraud. To the list of so-called "ape men" that includes Piltdown Man and Nebraska Man we can now add Hahnhöfersand Man, Binshof-Speyer Woman, and Paderborn-Sande Man. These world-renowned "missing links", upon which the whole edifice of human Evolutionism rested, have been discovered to have merely been the fanciful creation of a German Evolutionist named Professor Reiner Protsch von Zieten. Apparently the professor, who was also accused of selling chimpanzee skulls on the black market to fund his lavish Evolutionist lifestyle of fast cars and Cuban cigars, couldn't work his confounded carbon-dating machine, so he just started making up dates for fossils. (Wait, isn't that how they are supposed to work?) Even ardent Evolutionists are admitting defeat. According to secular professor Thomas Terberger, "Anthropology is going to have to completely revise its picture of modern man between 40,000 and 10,000 years ago". This is the imaginary period just prior to God's actual Creation that is crucial to Evolutionists' need to tie their Microbes-to-Man story to reality. Maybe this time they can get Michael Crichton to help with the rewrite. He at least has shown the ability to interject a note of realism with Man/Dinosaur contemporaniety, albeit in a twisted and violent way.
What's Next? Oompa Loompas?
11/02/2004 Evolutionists are claiming to have discovered a race of non-human "Hobbits" (which they have dubbed Homo floresiensis, or "Flores Man") that once lived on the Indonesian island of Flores 18,000 years ago (three time longer than the age of the Universe!) Of course, this is all nonsense, as Carl Wieland from AiG has clearly shown that these so-called Hobbits were really just common human dwarfs from the post-Babel diaspora, possibly suffering from Fall-related genetic diminution similar to that exhibited in the pygmies and apatosaurs I encountered in the Congo. There is also clear anthropological evidence that these island dwarfs (known as "Ebu Gogo" to the non-dwarf natives of Indonesia) were living on Flores as recently as a few hundred years ago, before they were driven out by tribal warfare.
Evolutionists Uncover Long Lost Boat...
2/17/2004 ...which isn't the Ark (of course, they refuse to even look for the Ark. Out of mind, out of sight.) No, the boat they have found is the HMS Beagle, a ship that was once captained by Robert Fitzroy during a five year circumnavigation of the world. This strongly Christian captain had the misfortune to have aboard a bothersome, young passenger and failed divinity school graduate who would later start an anti-Christian cult: Charles Darwin. Because of this, the Beagle is very important to Evolutionists, who have been searching for it for well over a century. Now that they believe they've found it, they want to raise it out of the Essex marsh it's been mired in and turn the icon of Darwinism into a religious shrine for pilgrims to visit, presumably as part of their Darwin Day activities.
Religious Holiday For Evolutionists
2/12/2004 Evolutionists and other assorted Atheists are campaigning to make February 12th a holiday celebrating the birth of the prophet of Evolutionism, Charles Darwin. They hope to have international recognition for "Darwin Day" by 2009. (Does this mean that they are giving up on their Santamas scheme?) Besides the obvious lie this puts to their claims of not being a religion, what should we make of this holiday falling on the same date as noted Christian president Abraham Lincoln's birthday, whom Atheists have been desparately trying to paint as one of their own through a historical revisionism campaign?
Book Banning In Our Nation's Parks
1/9/2004 Evolutionists are trying to ban a book from being sold at stores in the Grand Canyon National Park. The book, Grand Canyon: A Different View -- which includes stunning photos and numerous essays by prominent researchers such as Dr. Ken Ham and Dr. Steven Austin -- provides an alternative viewpoint, backed by sound Creation Science, on the origin of the canyon. Because it does not regurgitate the Darwinian party line, it has gotten Evolutionists all in a tizzy and they are demanding that it be removed. In an act of segregation aimed at appeasing Evolutionists, it was moved from the natural sciences section where it belongs to the inspirational reading section. Even hidden away in that ghetto, it still sold out.

Apparently, the park "interpretive staff" -- those people in the funny hats and shorts whose job it is to harass visitors with forcible reinterpretations of the Grand Canyon from a false Uniformitarian perspective -- are flummoxed by visitors asking embarrassing questions that they picked up from the book. They can't have people thinking for themselves, now can they? (See, this is what happens when we surrender sovereignty over our canyons to the UN.)

Homo Chimps
5/20/2003 Not satisfied with having monkeys for uncles, Evolutionists now want chimpanzees for brothers. They are trying to argue that, based on genetic similarity, chimps (currently known as Pan troglodytes) should be placed in the genus Homo -- which is the sole (or should we say "soul?") domain of Humans -- thereby making the newly re-christened Homo troglodytes a Human, if in name only. (Of course, these names will all eventually be replaced with Evolutionist barcodes, so perhaps we shouldn't worry too much just yet about uppity chimps demanding the vote.)

And wacky Evolutionisms just aren't complete without Richard Dawkins rearing his temporal-lobe-sensitivity-deprived head:

"Richard Dawkins perhaps provided the best visual for our link to chimps," Fouts told Discovery News. "Imagine taking the hand of your grandmother, who was holding the hand of her grandmother and so on down the line. 155 miles out, one of the women would be holding the hand of a chimpanzee."

Not only is this a sick perversion of Hands Across America, it is factually incorrect. That line would only be 50 feet long and would end in Eve.

Evolutionists To Place Mark of the Beast on the Beasts
3/16/2003 Evolutionary taxonomists are planning to replace the current binomial nomenclature -- invented by noted Christian naturalist Carolus Linnaeus as a testament to God's Creative Power -- with a system of barcodes based on snippets of DNA. Your furry household chum, Felis domesticus, will now be officially known as TACTCTTTACCTTTTATTCG, or more ominously:

CAT is now TACTCTTTACCTTTTATTCG

(Since the Evolutionists consider Man to be just another beast, Homo sapiens will have its own barcode as well. Furthermore, with Richard Dawkins' concept of a Citizen DNA Database, you will eventually be forced to replace your name with a tattoo-friendly DNA barcode.)

Apparently, Evolutionists are having a hard time making the binomial system -- which is based on Creation science -- fit with their Atheistic theories (just how does a member of one genus Evolve into another genus, Mr Darwin?) and have decided to scrap the whole thing in favor of a confusing array of inscrutable lines of varying thickness. Now only supermarket cashiers will be able to see through the Darwinian deceit, and unfortunately they are all too dim-witted to question the pseudoauthority of the Evolutionist establishment.

Here's a telling quote from the article: "Just what Darwin would make of it is not clear, but Dr Thomas believes he would be in favour: 'I think he would really love it,' he said." Indeed, I'd wager he would.

NCSE's "Project Steve" Is a Mockery of Science
2/24/2003 The Orwellianly named National Center for Science Education (whose unscientific goal is to "defend the teaching of Evolution in the public schools") has a new project called "Project Steve," which aims to get as many Evolutionists named Steve as they can muster to sign an affirmation of belief in Evolutionism so that their names can then be put on a t-shirt and sold to bitter Atheists.

The stated goal of this project is to mock Creation Science. Now when confronted with a list of scientists who doubt Evolutionism (scientists who, in years past, the Evolutionists have denied even existed,) the Darwinian faithful are supposed to ask the trite question "How many Steves do you have?" Unable to actually address the fact and theology of Creation, this Evolutionist propaganda organization has devolved into puerile attempts at cleverness in order to convince public school students that there is anything to this whole Evolutionism thing (I suppose next they will want a "Project Adam and Steve" for the public schools.)

But how did they get so many people named Steve to sign? In the Secularly Correct atmosphere of modern Academia, it is very easy to cajole and intimidate people into signing things like this. Refusal could be viewed as heresy and cause the refusenik to be denied letters of recommendation, tenure, or publication in the Evolutionist-reviewed journals (the academic equivalent of a death sentence.)

We also have to wonder how many of these "Steves" are really named Steve. Evolutionists are not above fraud, as evidenced by Nebraska Man, Archaeoraptor, and Lucy's knee. Are there any "Piltdown Steves" on that list? And how many are young scientists named by their Atheistic parents in "honor" of Stephen J. Gould (in much the same way as Mohammedans name their children Mohammed,) making the whole thing a circular argument?

Evolutionists: "Universe Really Old, Ruled By Dark Forces"
2/13/2003 While propagandizing the false belief in an ultra-ancient Universe, Secular Scientists alleged that 73% of the Universe is made of "Dark Energy." Dark Energy, a reputed force that repels objects, is the latest attempt to rationalize the "Big Bang" belief. The rationale for presupposing this energy is that it makes the Cosmos expand, which is, they claim, how the Universe went from an Atheistic nothing to the awesome expanse that it is today.

First called "quintessence" (Latin for "fifth element," a reference to the Pagan material-occultic belief in four basic elements: earth, wind, fire, water,) Dark Energy has since been given its new, more ominous moniker by the Cosmologists. Cosmology -- the branch of Evolutionism that tries to explain how a Godless Universe created itself -- has long had a history of promoting Atheism: first trying to unseat the Lord from the Heavens and then denying Him any role in their Creation. But this new development is even more troubling, since they are now claiming that the Universe is actually ruled by a repellant Dark force. Are we seeing the final step in the Evolutionistic agenda: the replacement of God with Satan?

(As an aside... in the article, Cosmology was aptly -- if unintentionally -- summed up by Secular Scientist John Bahcall, who, presumably speaking on behalf of Atheists everywhere, said: "We live in an implausible, crazy universe." You'll get no argument from me on that, John.)

Man Now Descended From Aardvark, Say Evolutionists
1/21/2003 The weight of pro-Creation evidence is forcing Evolutionists to frantically update their 150+-year-old fairytale. In a desperate change of course from the whole "monkey's uncle" argument, Evolutionists are now insisting that they are the grandchildren of "earth pigs." That's right -- your dear, old grandpapa wasn't a descendant of Noah, but rather resembled "a hump-backed, long-snouted overgrown rat." Honestly, I think they just picked the first animal in the dictionary.
Secular Scientists Back-Peddle: Universe Now Beige
GOD KNOWS!
Beige now? Only God can say for sure!
3/17/2002 Unlike the consistency that you can rely on from Creation Science, Secular Science is constantly changing its mind -- one day making bold proclamations about the nature of the Universe, the next day taking it all back. Well, it's happened again. Secular scientist are now saying that they goofed up and now believe the Universe to be beige in hue. So just what is the real color? We'll never learn for sure unless we start paying more attention to our Bibles and less to the whims and fancies of Man. If these Secular scientists can get something as simple as a color wrong, how can you trust them to get the origins of life right?
Dr. Laura Soft On Evolutionism
2/27/2002 Noted conservative (Orthodox Jewish) radio talkshow host Dr Laura Schlessinger exposes her audience -- most tuning in for psychiatric guidance due to emotional problems - to dangerous Evolutionismist philosophy. Is this malpractice or did Dr. Laura herself suffer an emotional breakdown?
Secular Scientists Discover Universe is Green
GOD DID IT!
The Truth is hidden in the color of the Universe.
1/12/2002 A new study shows that the average color of all the stars in the Universe is green, a color that is also smack dab in the middle of the human eye's range of color vision. Why would a blind watchmaker like Evolutionism give us eyes that correspond to the color of Heaven? What material "selective advantage" could that possibly serve? Clearly this is further confirmation of Intelligent Design.

Please visit the following good Christian business:

Pat's Age-Defying Protein Shake